Skip to main content

eSpCas9(1.1)-Puro
(Plasmid #117686)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117686 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 117686-D50 50 μg of DNA in Tris buffer $495
DNA 117686-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro
  • Backbone manufacturer
    Feng Zhang Lab
  • Backbone size w/o insert (bp) 9175
  • Total vector size (bp) 9175
  • Modifications to backbone
    K (AAG) 848 A (GCC), K (AAG) 1003 A (GCG), R (CGG) 1060 A (GCG)
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    eSpCas9(1.1)
  • Alt name
    K848A, K1003A, R1060A
  • Species
    Synthetic
  • Mutation
    K848A, K1003A, R1060A
  • Promoter U6
  • Tag / Fusion Protein
    • PuroR (R166H)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ApaI (not destroyed)
  • 3′ cloning site BsmI (not destroyed)
  • 5′ sequencing primer ACCCATTCCTGAAGGACAAC
  • 3′ sequencing primer TGGCCAGGTACAGGAAGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Created by Yang LIU and Luc LEYNS ([email protected]) from the Vrije Universiteit Brussel (Belgium).

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eSpCas9(1.1)-Puro was a gift from Luc Leyns (Addgene plasmid # 117686 ; http://n2t.net/addgene:117686 ; RRID:Addgene_117686)
  • For your References section:

    Loss of Emp2 compromises cardiogenic differentiation in mouse embryonic stem cells. Liu Y, Dakou E, Meng Y, Leyns L. Biochem Biophys Res Commun. 2019 Feb 14. pii: S0006-291X(19)30235-9. doi: 10.1016/j.bbrc.2019.02.048. 10.1016/j.bbrc.2019.02.048 PubMed 30773261