Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBS U6 WIP RNAi
(Plasmid #11774)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 11774 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBS-U6-RNAi-dual-CMV-GFP
  • Backbone manufacturer
    Yang Shi's lab (Harvard Medical School)
  • Backbone size w/o insert (bp) 3500
  • Vector type
    Mammalian Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    WIP RNAi
  • Alt name
    WASp Interacting Protein
  • Alt name
    WIP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    60
  • Entrez Gene
    WIPF1 (a.k.a. PRPL-2, WAS2, WASPIP, WIP)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer M13 forward 20
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Yang Shi (Harvard Medical School) provided the pBS-U6 empty vector.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

RNAi directed against this sequence in WIP: GGAGGTTTCCTGTGCCTTCT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBS U6 WIP RNAi was a gift from Jack Strominger (Addgene plasmid # 11774 ; http://n2t.net/addgene:11774 ; RRID:Addgene_11774)
  • For your References section:

    Formation of a WIP-, WASp-, actin-, and myosin IIA-containing multiprotein complex in activated NK cells and its alteration by KIR inhibitory signaling. Krzewski K, Chen X, Orange JS, Strominger JL. J Cell Biol. 2006 Apr 10. 173(1):121-32. 10.1083/jcb.200509076 PubMed 16606694