pCarCBADE
(Plasmid
#117757)
-
PurposeCodon optimized CarCBADE enzymes from Pectobacterium carotovorum in pBbaA5k backbone
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117757 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBbaA5k
-
Backbone manufacturerGenebank
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCodon optimised CarCBA, Protein CarD, Ferredoxin CarE
-
Alt nameCarCBADE
-
SpeciesPectobacterium carotovorum
-
Insert Size (bp)3710
-
GenBank ID
- Promoter PLac(UV5)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GCGTAGAGGATCGAGATCG
- 3′ sequencing primer AACGCCCTAGGTATAAACGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCarCBADE was a gift from Greg Bokinsky (Addgene plasmid # 117757 ; http://n2t.net/addgene:117757 ; RRID:Addgene_117757) -
For your References section:
Metabolic engineering of a carbapenem antibiotic synthesis pathway in Escherichia coli. Shomar H, Gontier S, van den Broek NJF, Tejeda Mora H, Noga MJ, Hagedoorn PL, Bokinsky G. Nat Chem Biol. 2018 Aug;14(8):794-800. doi: 10.1038/s41589-018-0084-6. Epub 2018 Jun 25. 10.1038/s41589-018-0084-6 PubMed 29942079