Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #117773)


Item Catalog # Description Quantity Price (USD)
Plasmid 117773 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Karl J. Clark
  • Backbone size w/o insert (bp) 2856
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    3x3 Stop sequence
  • Alt name
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aaaagcaagaaagaaaactagagtgg
  • 3′ sequencing primer atggctcataacaccccttg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Depositor Comments

Secondary gene is a gamma-crystalin promoter driving NLS-eGFP. Online tools and cloning help available at <>. May work in additional species beyond those listed. Please note that some discrepancies were found between Addgene's quality control result and the depositor's provided sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPRISM-Stop-gcry-eGFP was a gift from Jeffrey Essner (Addgene plasmid # 117773 ; ; RRID:Addgene_117773)
  • For your References section:

    GeneWeld: a method for efficient targeted integration directed by short homology. Wierson WA, Welker JM, Almeida MP, Mann CM, Webster DA, Weiss TJ, Torrie ME, Vollbrecht MK, Lan M, McKeighan KC, Ming Z, Wehmeier A, Mikelson CS, Haltom JA, Kwan KM, Chien CB, Balciunas D, Ekker SC, Clark KJ, Webber BR, Moriarity B, Solin SL, Carlson DF, Dobbs DL, McGrail M, Essner JJ.. bioRxiv 431627 10.1101/431627