Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #118000)


Item Catalog # Description Quantity Price (USD)
Plasmid 118000 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pN_35S/mCitrine (Addgene plasmid 117993)
  • Backbone size w/o insert (bp) 2028
  • Total vector size (bp) 12373
  • Modifications to backbone
    Added A. thaliana ubiquitin 10 promoter (P_UBQ10) and nosT terminator (nosT) to backbone. Insert resides between UBQ10 and nosT.
  • Vector type
    Plant Expression ; Plant/bacteria binary vector
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
  • Promoter Ubiquitin-10

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAGTTTCTAGTTTGTGCGATCG
  • 3′ sequencing primer TCATCGCAAGACCGGCAACA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pN_35S/mCitrine/P_UBQ10/Derlin1-mOrange2 was a gift from Mathias Pribil (Addgene plasmid # 118000 ; ; RRID:Addgene_118000)
  • For your References section:

    Membrane-bound protein scaffolding in diverse hosts using thylakoid protein CURT1A. Behrendorff JBYH, Sandoval-Ibanez OA, Sharma A, Pribil M. ACS Synth Biol. 2019 Mar 18. doi: 10.1021/acssynbio.8b00418. 10.1021/acssynbio.8b00418 PubMed 30884945