pXPR003-sgTP53-1
(Plasmid
#118019)
-
PurposeConstitutive expression of sgRNA targeting human TP53
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118019 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepXPR003
-
Backbone manufacturerFeng Zhang Lab
- Backbone size w/o insert (bp) 9482
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgTP53-1
-
gRNA/shRNA sequenceACTTCCTGAAAACAACGTTC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)100
-
Entrez GeneTP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer hU6
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
High efficiency of TP53 deletion
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXPR003-sgTP53-1 was a gift from William Hahn & David Root (Addgene plasmid # 118019 ; http://n2t.net/addgene:118019 ; RRID:Addgene_118019) -
For your References section:
Mutational processes shape the landscape of TP53 mutations in human cancer. Giacomelli AO, Yang X, Lintner RE, McFarland JM, Duby M, Kim J, Howard TP, Takeda DY, Ly SH, Kim E, Gannon HS, Hurhula B, Sharpe T, Goodale A, Fritchman B, Steelman S, Vazquez F, Tsherniak A, Aguirre AJ, Doench JG, Piccioni F, Roberts CWM, Meyerson M, Getz G, Johannessen CM, Root DE, Hahn WC. Nat Genet. 2018 Oct;50(10):1381-1387. doi: 10.1038/s41588-018-0204-y. 10.1038/s41588-018-0204-y PubMed 30224644