-
PurposeMulti-luciferase reporter vector including transcriptional reporters for NF-kb, TGF-b, c-Myc, p53 and MAPK/JNK transcriptional reporters
-
Depositing Lab
-
Depositing OrganizationBaylor College of Medicine
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118069 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 118069-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 118069-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneColE1 vector Alpha2
-
Backbone manufacturerSelf made; Derived from pBluescriptSK
- Backbone size w/o insert (bp) 2327
- Total vector size (bp) 13382
-
Modifications to backboneKanamycin Resistance
-
Vector typeMammalian Expression, Luciferase, Synthetic Biology ; Assembly of GB2.0 transcriptional units
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTB:5xNF-κβ:RedF:bGHpA
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2205
- Promoter 5xNF-KB::miniP
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer cgctGTCAggagGGGAATTTC
- 3′ sequencing primer AAGCTCACATCTTGGCCACGGGC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTB:4xTGF-β:FLuc:bGHpA
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2111
- Promoter 4xTGF-B::miniP
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer TTCTCTcgctGTCAGGAGG
- 3′ sequencing primer TAGAAGGCACAGAAGCttacacggcga
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameTB:5xE-box:Renilla:bGHpA
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1477
- Promoter 5xEbox::miniP
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer ATTTCTCTcgctGTCAGGAGCACGTGTGC
- 3′ sequencing primer GAACAGTGAGCTTCTGTGCCTTCTAGTTGCCAGC
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameTB:2xp53:NLuc:bGHpA
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1076
- Promoter 2xp53::miniP
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer ATTTCTCTcgctGTCAGGAGTACAGAAC
- 3′ sequencing primer CCTGAGCTTCTGTGCCTTCTAGTTGCCAGCCATCT
- (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameTB:6xAP-1:GrRenilla:bGHpA
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1497
- Promoter 6xAP1::miniP
Cloning Information for Gene/Insert 5
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer ATTTCTCTcgctGTCAGGAGTGAGT
- 3′ sequencing primer GTGAGGCTTCTGTGCCTTCTAGTTGCCAGCCAT
- (Common Sequencing Primers)
Gene/Insert 6
-
Gene/Insert nameCMV:ELuc:bGHpA
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2449
- Promoter CMV
Cloning Information for Gene/Insert 6
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBi (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer CAGGAGTAGTTATTAATAGTAATCAATTACG
- 3′ sequencing primer CGGCTTGAGCTTCTGTGCCTTCTAGTTGCCAGCCA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert can be released with BsmBI
DNA (Catalog # 118069-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 118069-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MLRV was a gift from Koen Venken (Addgene plasmid # 118069 ; http://n2t.net/addgene:118069 ; RRID:Addgene_118069) -
For your References section:
Examining multiple cellular pathways at once using multiplex hextuple luciferase assaying. Sarrion-Perdigones A, Chang L, Gonzalez Y, Gallego-Flores T, Young DW, Venken KJT. Nat Commun. 2019 Dec 13;10(1):5710. doi: 10.1038/s41467-019-13651-y. 10.1038/s41467-019-13651-y PubMed 31836712