-
PurposeMulti-luciferase reporter vector including transcriptional reporters for NF-kb, TGF-b, c-Myc, p53 and MAPK/JNK transcriptional reporters
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118069 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneColE1 vector Alpha2
-
Backbone manufacturerSelf made; Derived from pBluescriptSK
- Backbone size w/o insert (bp) 2327
- Total vector size (bp) 13382
-
Modifications to backboneKanamycin Resistance
-
Vector typeMammalian Expression, Luciferase, Synthetic Biology ; Assembly of GB2.0 transcriptional units
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTB:5xNF-κβ:RedF:bGHpA
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2205
- Promoter 5xNF-KB::miniP
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer cgctGTCAggagGGGAATTTC
- 3′ sequencing primer AAGCTCACATCTTGGCCACGGGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTB:4xTGF-β:FLuc:bGHpA
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2111
- Promoter 4xTGF-B::miniP
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer TTCTCTcgctGTCAGGAGG
- 3′ sequencing primer TAGAAGGCACAGAAGCttacacggcga (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameTB:5xE-box:Renilla:bGHpA
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1477
- Promoter 5xEbox::miniP
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer ATTTCTCTcgctGTCAGGAGCACGTGTGC
- 3′ sequencing primer GAACAGTGAGCTTCTGTGCCTTCTAGTTGCCAGC (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameTB:2xp53:NLuc:bGHpA
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1076
- Promoter 2xp53::miniP
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer ATTTCTCTcgctGTCAGGAGTACAGAAC
- 3′ sequencing primer CCTGAGCTTCTGTGCCTTCTAGTTGCCAGCCATCT (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameTB:6xAP-1:GrRenilla:bGHpA
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1497
- Promoter 6xAP1::miniP
Cloning Information for Gene/Insert 5
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer ATTTCTCTcgctGTCAGGAGTGAGT
- 3′ sequencing primer GTGAGGCTTCTGTGCCTTCTAGTTGCCAGCCAT (Common Sequencing Primers)
Gene/Insert 6
-
Gene/Insert nameCMV:ELuc:bGHpA
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2449
- Promoter CMV
Cloning Information for Gene/Insert 6
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBi (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer CAGGAGTAGTTATTAATAGTAATCAATTACG
- 3′ sequencing primer CGGCTTGAGCTTCTGTGCCTTCTAGTTGCCAGCCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert can be released with BsmBI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MLRV was a gift from Koen Venken (Addgene plasmid # 118069 ; http://n2t.net/addgene:118069 ; RRID:Addgene_118069) -
For your References section:
Examining multiple cellular pathways at once using multiplex hextuple luciferase assaying. Sarrion-Perdigones A, Chang L, Gonzalez Y, Gallego-Flores T, Young DW, Venken KJT. Nat Commun. 2019 Dec 13;10(1):5710. doi: 10.1038/s41467-019-13651-y. 10.1038/s41467-019-13651-y PubMed 31836712