Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p5-39
(Plasmid #118088)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 118088 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    custom
  • Total vector size (bp) 5469
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FKBP-TSGGSG-Split C-terminal T7 RNAP expression plasmid

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctataatcacggcagaaaagtccacattg
  • 3′ sequencing primer ccactcatcgcagtactgttgtaattcattaagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p5-39 was a gift from Bryan Dickinson (Addgene plasmid # 118088 ; http://n2t.net/addgene:118088 ; RRID:Addgene_118088)
  • For your References section:

    Evolution of a split RNA polymerase as a versatile biosensor platform. Pu J, Zinkus-Boltz J, Dickinson BC. Nat Chem Biol. 2017 Apr;13(4):432-438. doi: 10.1038/nchembio.2299. Epub 2017 Feb 13. 10.1038/nchembio.2299 PubMed 28192413