Skip to main content

p6-8
(Plasmid #118089)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118089 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    custom
  • Total vector size (bp) 7857
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Rapamycin-inducible split T7 RNAP with T7 driven mRNA for GFP
  • Species
    H. sapiens (human); Evolved genes

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTCATGAGATTATCAAAAAGGA
  • 3′ sequencing primer TGCATTCATTTTATGTTTCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p6-8 was a gift from Bryan Dickinson (Addgene plasmid # 118089 ; http://n2t.net/addgene:118089 ; RRID:Addgene_118089)
  • For your References section:

    Evolution of a split RNA polymerase as a versatile biosensor platform. Pu J, Zinkus-Boltz J, Dickinson BC. Nat Chem Biol. 2017 Apr;13(4):432-438. doi: 10.1038/nchembio.2299. Epub 2017 Feb 13. 10.1038/nchembio.2299 PubMed 28192413