Skip to main content
Holiday Schedule: Addgene will be closed December 23 - January 2. Order processing and shipping will resume on January 3, 2023. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #118276)


Item Catalog # Description Quantity Price (USD)
Plasmid 118276 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Bong-Kiun Kaang
  • Backbone size w/o insert (bp) 3771
  • Total vector size (bp) 5591
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number

Gene/Insert 1

  • Gene/Insert name
  • Insert Size (bp)
  • GenBank ID
  • Promoter CamK II
  • Tag / Fusion Protein
    • P2A (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer GTTCTCCGTTTGCACTCAGGA
  • 3′ sequencing primer GGGTTCTCCTCCACGTCTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • GenBank ID
  • Promoter CamK II

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGGAGCTACTAACTTCAGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CamKII-GFP-P2A-bReaches-minWPRE was a gift from Dietmar Schmitz (Addgene plasmid # 118276 ; ; RRID:Addgene_118276)
  • For your References section:

    Potassium channel-based optogenetic silencing. Bernal Sierra YA, Rost BR, Pofahl M, Fernandes AM, Kopton RA, Moser S, Holtkamp D, Masala N, Beed P, Tukker JJ, Oldani S, Bonigk W, Kohl P, Baier H, Schneider-Warme F, Hegemann P, Beck H, Seifert R, Schmitz D. Nat Commun. 2018 Nov 5;9(1):4611. doi: 10.1038/s41467-018-07038-8. 10.1038/s41467-018-07038-8 PubMed 30397200