Skip to main content
Addgene

pAAV-EF1a-SwitchON_mRubyNLS-hChR2(H134R)-EYFP-NO_WPRE
(Plasmid #118279)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118279 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4741
  • Total vector size (bp) 7376
  • Modifications to backbone
    Backbone derived from Addene 20298.
  • Vector type
    AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mRuby2
  • Species
    Synthetic; Entacmaea quadricolor.
  • Insert Size (bp)
    708
  • GenBank ID
    AFR60232
  • Promoter EF1 alpha
  • Tag / Fusion Protein
    • SV40 NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Spe I (not destroyed)
  • 3′ cloning site Nde I (destroyed during cloning)
  • 5′ sequencing primer pEFmyccyto-F (TCTCAAGCCTCAGACAGT)
  • 3′ sequencing primer EGFP_C_F (gaagcgcgatcacatggtc)
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ChR2(H134R)
  • Alt name
    channelrhodopsin 2 (H134R)
  • Species
    Synthetic
  • Insert Size (bp)
    945
  • Promoter EF1 alpha
  • Tag / Fusion Protein
    • YFP (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asc I (not destroyed)
  • 3′ cloning site Nhe I (not destroyed)
  • 5′ sequencing primer EGFP-N1 (acttgtggccgtttacgtc)
  • 3′ sequencing primer CMV5-R (AGAAGGACACCTAGTCAGAC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Becaus of the missing WPRE, a high titer virus production (≥ 1×10¹³ vg/mL) is required for efficient gene expression,

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-SwitchON_mRubyNLS-hChR2(H134R)-EYFP-NO_WPRE was a gift from Dietmar Schmitz (Addgene plasmid # 118279 ; http://n2t.net/addgene:118279 ; RRID:Addgene_118279)
  • For your References section:

    VGLUT2 Functions as a Differential Marker for Hippocampal Output Neurons. Wozny C, Beed P, Nitzan N, Possnecker Y, Rost BR, Schmitz D. Front Cell Neurosci. 2018 Oct 2;12:337. doi: 10.3389/fncel.2018.00337. eCollection 2018. 10.3389/fncel.2018.00337 PubMed 30333731