Skip to main content

pAAV-DYRK3-2A-mCherry
(Plasmid #118287)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118287 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-2A-mCherry
  • Backbone size w/o insert (bp) 5410
  • Total vector size (bp) 7168
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
  • Alt name
    DYRK3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1758
  • GenBank ID
    BC006704.1 NM_145508.2
  • Entrez Gene
    Dyrk3 (a.k.a. BC006704)
  • Promoter CMV with beta global intron
  • Tags / Fusion Proteins
    • 2A peptide (C terminal on insert)
    • mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI to XhoI (destroyed during cloning)
  • 5′ sequencing primer TGGTTGGGATAAGGCTGGAT
  • 3′ sequencing primer TTCAGCTTGGCGGTCTGGGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-DYRK3-2A-mCherry was a gift from Vance Lemmon (Addgene plasmid # 118287 ; http://n2t.net/addgene:118287 ; RRID:Addgene_118287)
  • For your References section:

    Dyrk kinases regulate phosphorylation of doublecortin, cytoskeletal organization, and neuronal morphology. Slepak TI, Salay LD, Lemmon VP, Bixby JL. Cytoskeleton (Hoboken). 2012 Jul;69(7):514-27. doi: 10.1002/cm.21021. Epub 2012 Mar 7. 10.1002/cm.21021 PubMed 22359282