Skip to main content

HA-GFP1-10-actin-pcDNA4-TO
(Plasmid #118370)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118370 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA4-TO
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    actin beta
  • Alt name
    ACTB
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1127
  • Entrez Gene
    ACTB (a.k.a. BKRNS, BNS, BRWS1, CSMH, DDS1, PS1TP5BP1, THC8)
  • Promoter CMV/TO
  • Tag / Fusion Protein
    • HA-GFP1-10 (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/445973v1 for BioRxiv preprint

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HA-GFP1-10-actin-pcDNA4-TO was a gift from Maria Vartiainen (Addgene plasmid # 118370 ; http://n2t.net/addgene:118370 ; RRID:Addgene_118370)
  • For your References section:

    Nuclear actin interactome analysis links actin to KAT14 histone acetyl transferase and mRNA splicing. Viita T, Kyheroinen S, Prajapati B, Virtanen J, Frilander MJ, Varjosalo M, Vartiainen MK. J Cell Sci. 2019 Apr 17;132(8). pii: jcs.226852. doi: 10.1242/jcs.226852. 10.1242/jcs.226852 PubMed 30890647