-
PurposeEntry clone containing CAS9p-TagRFP and 35S terminator. Used to make CRISPR construct . For use in plants and compatible with the MultiSite Gateway system
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118386 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDONR-221z
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCAS9p-TagRFP
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer M13 Forward (-20) gtaaaacgacggccag
- 3′ sequencing primer T7 universal primer, taatacgactcactataggg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p221z-CAS9p-TagRFP-t35s was a gift from Ari Pekka Mähönen (Addgene plasmid # 118386 ; http://n2t.net/addgene:118386 ; RRID:Addgene_118386) -
For your References section:
An inducible genome editing system for plants. Wang X, Ye L, Lyu M, Ursache R, Loytynoja A, Mahonen AP. Nat Plants. 2020 Jun 29. pii: 10.1038/s41477-020-0695-2. doi: 10.1038/s41477-020-0695-2. 10.1038/s41477-020-0695-2 PubMed 32601420