Skip to main content

p2R3z-BASI-ccdB-BSAI
(Plasmid #118389)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118389 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDONR-P2R-P3z
  • Vector type
    Unspecified

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DB3.1
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ccdB
  • Mutation
    See Depositor Comments Section

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer M13 Forward (-20) gtaaaacgacggccag
  • 3′ sequencing primer T7 universal primer, taatacgactcactataggg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene NGS identified an in-frame insertion in the ccdB gene in this plasmid, the depositing lab confirmed that this variant was present in their initial stock of the plasmid and has functioned as expected.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p2R3z-BASI-ccdB-BSAI was a gift from Ari Pekka Mähönen (Addgene plasmid # 118389 ; http://n2t.net/addgene:118389 ; RRID:Addgene_118389)
  • For your References section:

    An inducible genome editing system for plants. Wang X, Ye L, Lyu M, Ursache R, Loytynoja A, Mahonen AP. Nat Plants. 2020 Jun 29. pii: 10.1038/s41477-020-0695-2. doi: 10.1038/s41477-020-0695-2. 10.1038/s41477-020-0695-2 PubMed 32601420