-
PurposeTo express in mammalian cells a lactate FRET sensor negative control.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118627 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1(-)
-
Backbone manufacturerThermoFisher Scientific
- Backbone size w/o insert (bp) 5419
- Total vector size (bp) 7648
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDead-Laconic
-
SpeciesSynthetic
-
Insert Size (bp)2229
-
MutationChange Histidine 151 to Aspartic Acid of Escherichia coli LldR
- Promoter CMV Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Dead-Laconic/pcDNA3.1(-) was a gift from Luis Felipe Barros (Addgene plasmid # 118627 ; http://n2t.net/addgene:118627 ; RRID:Addgene_118627) -
For your References section:
Monitoring Lactate Dynamics in Individual Macrophages with a Genetically Encoded Probe. Baeza-Lehnert F, Flores CA, Guequen A, Barros LF. Methods Mol Biol. 2020;2184:19-30. doi: 10.1007/978-1-0716-0802-9_2. 10.1007/978-1-0716-0802-9_2 PubMed 32808215