Skip to main content

HF-PX459 (V2)
(Plasmid #118632)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118632 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PX459
  • Backbone manufacturer
    Dr. Feng Zhang Lab
  • Total vector size (bp) 9175
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hSpCas9-HF1-2A-Puro V2.0
  • Alt name
    SpCas9-HF1-2a-puro V2.0
  • Alt name
    HF-PX459 V2.0
  • Alt name
    Cas9-HF1
  • Species
    Synthetic
  • Insert Size (bp)
    6179
  • Mutation
    Asparagine 497 to Alanine, Arginine 661 to Alanine, Glutamine 695 to Alanine, and Glutamine 926 to Alanine
  • Promoter Cbh
  • Tags / Fusion Proteins
    • 3XFLAG (N terminal on insert)
    • 2A-Puro (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAGCAGCGGACCTTCGACAA
  • 3′ sequencing primer CTTTCCAGCTTAGGGTACTTT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This is a SpCas9-HF1 plasmid generated by cloning a 1430-bp nucleotide region of SpCas9-HF1 in VP12 (Addgene plasmid #72247) encoding the four amino acid substitutions (N497A, R661A, Q695A and Q926A) into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988).

Recipients of this material should add the following reference to their publication: “Idoko-Akoh A, Taylor L, Sang HM, McGrew MJ(2018). High fidelity CRISPR/Cas9 increases precise monoallelic and biallelic editing events in primordial germ cells. Scientific Reports 8:15126”

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HF-PX459 (V2) was a gift from Mike McGrew (Addgene plasmid # 118632 ; http://n2t.net/addgene:118632 ; RRID:Addgene_118632)
  • For your References section:

    High fidelity CRISPR/Cas9 increases precise monoallelic and biallelic editing events in primordial germ cells. Idoko-Akoh A, Taylor L, Sang HM, McGrew MJ. Sci Rep. 2018 Oct 11;8(1):15126. doi: 10.1038/s41598-018-33244-x. 10.1038/s41598-018-33244-x PubMed 30310080