pGL421_MLL_promoter
(Plasmid
#118695)
-
PurposeExpress MLL/KMT2A promoter for luciferase assay
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118695 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL421
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5512
- Total vector size (bp) 6295
-
Vector typeLuciferase
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMLL_promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)783
- Promoter MLL/KMT2A promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAGCAAAATAGGCTGTCCCCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL421_MLL_promoter was a gift from Christopher Vakoc (Addgene plasmid # 118695 ; http://n2t.net/addgene:118695 ; RRID:Addgene_118695) -
For your References section:
A Transcription Factor Addiction in Leukemia Imposed by the MLL Promoter Sequence. Lu B, Klingbeil O, Tarumoto Y, Somerville TDD, Huang YH, Wei Y, Wai DC, Low JKK, Milazzo JP, Wu XS, Cao Z, Yan X, Demerdash OE, Huang G, Mackay JP, Kinney JB, Shi J, Vakoc CR. Cancer Cell. 2018 Dec 10;34(6):970-981.e8. doi: 10.1016/j.ccell.2018.10.015. Epub 2018 Nov 29. 10.1016/j.ccell.2018.10.015 PubMed 30503706