pGL421_MLL_promoter
(Plasmid
#118695)
-
PurposeExpress MLL/KMT2A promoter for luciferase assay
-
Depositing Lab
-
Depositing OrganizationCold Spring Harbor Laboratory
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118695 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 118695-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 118695-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL421
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5512
- Total vector size (bp) 6295
-
Vector typeLuciferase
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMLL_promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)783
- Promoter MLL/KMT2A promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAGCAAAATAGGCTGTCCCCA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 118695-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 118695-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL421_MLL_promoter was a gift from Christopher Vakoc (Addgene plasmid # 118695 ; http://n2t.net/addgene:118695 ; RRID:Addgene_118695) -
For your References section:
A Transcription Factor Addiction in Leukemia Imposed by the MLL Promoter Sequence. Lu B, Klingbeil O, Tarumoto Y, Somerville TDD, Huang YH, Wei Y, Wai DC, Low JKK, Milazzo JP, Wu XS, Cao Z, Yan X, Demerdash OE, Huang G, Mackay JP, Kinney JB, Shi J, Vakoc CR. Cancer Cell. 2018 Dec 10;34(6):970-981.e8. doi: 10.1016/j.ccell.2018.10.015. Epub 2018 Nov 29. 10.1016/j.ccell.2018.10.015 PubMed 30503706