- 
            PurposeContains an optimized 48-mer TetO repeat for imaging of desired loci
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118712 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepSP2
 - Total vector size (bp) 6837
 - 
              Vector typeMammalian Expression
 - 
                Selectable markersBlasticidin
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)NEB Stable
 - 
            Copy numberLow Copy
 
Gene/Insert 1
- 
                Gene/Insert nameBlasticidin resistance gene
 - 
                  Insert Size (bp)880
 
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
 - 5′ cloning site HindIII (not destroyed)
 - 3′ cloning site BstBI (not destroyed)
 - 5′ sequencing primer TAGAGAGTATAGAGGGTCC
 - 3′ sequencing primer CTTAAGCTAGCAGCGCTCTCG (Common Sequencing Primers)
 
Gene/Insert 2
- 
                Gene/Insert nameEFS-NS promoter
 - 
                  Insert Size (bp)278
 - Promoter EFS-NS
 
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
 - 5′ cloning site NdeI (not destroyed)
 - 3′ cloning site HindIII (not destroyed)
 - 5′ sequencing primer TAGAGAGTATAGAGGGTCC (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 - 
            A portion of this plasmid was derived from a plasmid made by48-mer TetO sequence was cloned by Gabriela Sustackova (laboratory of Prof. Andrew Belmont)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pSP2-48-merTetO-EFS-BLaR was a gift from Huimin Zhao (Addgene plasmid # 118712 ; http://n2t.net/addgene:118712 ; RRID:Addgene_118712) - 
                
For your References section:
CRISPR/Cas9-mediated knock-in of an optimized TetO repeat for live cell imaging of endogenous loci. Tasan I, Sustackova G, Zhang L, Kim J, Sivaguru M, HamediRad M, Wang Y, Genova J, Ma J, Belmont AS, Zhao H. Nucleic Acids Res. 2018 Jun 15. pii: 5038283. doi: 10.1093/nar/gky501. 10.1093/nar/gky501 PubMed 29912475