Desmoplakin II donor only control (FL-based no force control)
(Plasmid
#118722)
-
PurposeThe donor (YPet(short)) only control for the no force control of the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in lifetime measurements to determine FRET.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118722 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLPCX
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6265
- Total vector size (bp) 11957
-
Modifications to backbonemodified multiple cloning site
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehuman Desmoplakin II (1-1353)-[YPet(short)-FL-mCherry(Y72L)]
-
Alt nameDesmoplakin II donor only control for FL-based no force control
-
Alt nameDPII-tr (YFLdC)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5715
-
Mutationtruncation after aa1353; Y72L mutation in mCherry to disrupt chromophore formation
-
GenBank IDNM_001008844.1
-
Entrez GeneDSP (a.k.a. DCWHKTA, DP)
- Promoter CMV
-
Tag
/ Fusion Protein
- YPet(short)-FL-mCherry(Y72L) (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ cloning site ECoRI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer AGCTcGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDesmoplakin I-GFP (Addgene, #32227) from Kathleen Green used as a template for Desmoplakin II and FL-based tension sensor module (Addgene, #101170) from Carsten Grashoff
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Desmoplakin II donor only control (FL-based no force control) was a gift from Carsten Grashoff (Addgene plasmid # 118722 ; http://n2t.net/addgene:118722 ; RRID:Addgene_118722) -
For your References section:
Mechanical loading of desmosomes depends on the magnitude and orientation of external stress. Price AJ, Cost AL, Ungewiss H, Waschke J, Dunn AR, Grashoff C. Nat Commun. 2018 Dec 11;9(1):5284. doi: 10.1038/s41467-018-07523-0. 10.1038/s41467-018-07523-0 PubMed 30538252