Desmoplakin II donor only control (FL-based tension sensor)
(Plasmid
#118723)
-
PurposeThe donor only (YPet(short)) control for the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in fluorescence lifetime measurements to determine FRET.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118723 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLPCX
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6265
- Total vector size (bp) 14708
-
Modifications to backbonemodified multiple cloning site
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehuman Desmoplakin II-[YPet(short)-FL-mCherry(Y72L)] (internal-1353)
-
Alt nameDesmoplakin II donor only control for FL-based tension sensor
-
Alt nameDPII-int (YFLdC)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)8481
-
Mutationinserted FL-based tension sensor module after aa1353: Y72L in mCherry mutation to disrupt chromophore formation
-
GenBank IDNM_001008844.1
-
Entrez GeneDSP (a.k.a. DCWHKTA, DP)
- Promoter CMV
-
Tag
/ Fusion Protein
- YPet(short)-FL-mCherry(Y72L)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCTcGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDesmoplakin I-GFP (Addgene, #32227) from Kathleen Green used as a template for Desmoplakin II and FL-based tension sensor module (Addgene, #101170) from Carsten Grashoff
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Desmoplakin II donor only control (FL-based tension sensor) was a gift from Carsten Grashoff (Addgene plasmid # 118723 ; http://n2t.net/addgene:118723 ; RRID:Addgene_118723) -
For your References section:
Mechanical loading of desmosomes depends on the magnitude and orientation of external stress. Price AJ, Cost AL, Ungewiss H, Waschke J, Dunn AR, Grashoff C. Nat Commun. 2018 Dec 11;9(1):5284. doi: 10.1038/s41467-018-07523-0. 10.1038/s41467-018-07523-0 PubMed 30538252