Desmoplakin I no force control (F40-based)
(Plasmid
#118726)
-
PurposeThe no force control for the F40-based human desmoplakin I tension sensor serves to detect changes in FRET between YPet(short) and mCherry that are tension-independent.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118726 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLPCX
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6265
- Total vector size (bp) 13631
-
Modifications to backbonemodified multiple cloning site
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehuman Desmoplakin I (1-1952)-[YPet(short)-F40-mCherry]
-
Alt nameDesmoplakin I no force control (F40-based)
-
Alt nameDPI-ctrl (YF40C)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)7386
-
Mutationtruncation after aa1952
-
GenBank IDNM_004415.2
-
Entrez GeneDSP (a.k.a. DCWHKTA, DP)
- Promoter CMV
-
Tag
/ Fusion Protein
- YPet(short)-F40-mCherry (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCTcGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDesmoplakin I-GFP (Addgene, #32227) from Kathleen Green and F40-based tension sensor module (Addgene, #101252) from Carsten Grashoff
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Desmoplakin I no force control (F40-based) was a gift from Carsten Grashoff (Addgene plasmid # 118726 ; http://n2t.net/addgene:118726 ; RRID:Addgene_118726) -
For your References section:
Mechanical loading of desmosomes depends on the magnitude and orientation of external stress. Price AJ, Cost AL, Ungewiss H, Waschke J, Dunn AR, Grashoff C. Nat Commun. 2018 Dec 11;9(1):5284. doi: 10.1038/s41467-018-07523-0. 10.1038/s41467-018-07523-0 PubMed 30538252