pDM_noro_A2_lacZ
(Plasmid
#118820)
-
PurposeT7 RNAP-driven expression of norovirus antisense orientation toehold switches (A2) with a lacZ reporter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118820 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCOLAduet
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNorovirus toehold switch A2
-
SpeciesSynthetic
-
Insert Size (bp)3238
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTTACTGGTTTCACATTCACCACCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Output gene is full-length lacZ
There is a single mutation A343V in LacI that will not affect plasmid function
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDM_noro_A2_lacZ was a gift from Alexander Green (Addgene plasmid # 118820 ; http://n2t.net/addgene:118820 ; RRID:Addgene_118820) -
For your References section:
Low-cost detection of norovirus using paper-based cell-free systems and synbody-based viral enrichment. Ma D, Shen L, Wu K, Diehnelt CW, Green AA. Synth Biol (Oxf). 2018;3(1):ysy018. doi: 10.1093/synbio/ysy018. Epub 2018 Sep 19. 10.1093/synbio/ysy018 PubMed 30370338