MiniCoopR U6:gRNA cdkn2a, mitfa:Cas9
(Plasmid
#118842)
-
PurposeTargets cdkn2a and expresses zebrafish mitfa specifically in zebrafish melanocytes
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118842 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMiniCoopR
-
Vector typeCRISPR ; Tol2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecdkn2a gRNA
-
gRNA/shRNA sequenceGTTCTGGCAGCGTCGTGCAG
-
SpeciesD. rerio (zebrafish)
-
Entrez GeneLOC100329528
Cloning Information
- Cloning method Gateway Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MiniCoopR U6:gRNA cdkn2a, mitfa:Cas9 was a gift from Leonard Zon (Addgene plasmid # 118842 ; http://n2t.net/addgene:118842 ; RRID:Addgene_118842) -
For your References section:
Human tumor genomics and zebrafish modeling identify SPRED1 loss as a driver of mucosal melanoma. Ablain J, Xu M, Rothschild H, Jordan RC, Mito JK, Daniels BH, Bell CF, Joseph NM, Wu H, Bastian BC, Zon LI, Yeh I. Science. 2018 Nov 1. pii: science.aau6509. doi: 10.1126/science.aau6509. 10.1126/science.aau6509 PubMed 30385465