pJKW1148
(Plasmid
#119029)
-
PurposeYeast expression plasmid for PmCYP719A26
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119029 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepYeDP60
- Backbone size w/o insert (bp) 9282
- Total vector size (bp) 10762
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePmCYP719A26
-
Alt namePmMTS1
-
SpeciesPiper methysticum
-
Insert Size (bp)1536
-
GenBank IDMK058499
- Promoter GAL10
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cttcttttctctaaatattctttc
- 3′ sequencing primer cttttcggataagaaagcaac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJKW1148 was a gift from Jing-Ke Weng (Addgene plasmid # 119029 ; http://n2t.net/addgene:119029 ; RRID:Addgene_119029) -
For your References section:
The biosynthetic origin of psychoactive kavalactones in kava. Pluskal T, Torrens-Spence MP, Fallon TR, De Abreu A, Shi CH, Weng JK. Nat Plants. 2019 Jul 22. pii: 10.1038/s41477-019-0474-0. doi: 10.1038/s41477-019-0474-0. 10.1038/s41477-019-0474-0 PubMed 31332312