- 
            Purpose3rd gen transfer vector. HLA-A0201 linked to b2-microglobulin and CD28-CD3z signaling domain. Contains the Mart1 epitope "ELAGIGILTV" cloned via BsmBI
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119052 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepCCLc-MND
- 
              Backbone manufacturerDonald B. Kohn's laboratory at UCLA
- Backbone size w/o insert (bp) 6600
- Total vector size (bp) 9000
- 
              Vector typeMammalian Expression, Lentiviral
- 
                Selectable markerssurface myc-tag
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameA0201-Mart1-SABR
- Promoter MND
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCTCCCCGAGCTCAATAAAAG
- 3′ sequencing primer TGGCTAAGATCTACAGCTGCCTT (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
- 
            Article Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pCCLc-MND-A0201-Mart1-SABR was a gift from David Baltimore (Addgene plasmid # 119052 ; http://n2t.net/addgene:119052 ; RRID:Addgene_119052)
- 
                For your References section: T cell antigen discovery via signaling and antigen-presenting bifunctional receptors. Joglekar AV, Leonard MT, Jeppson JD, Swift M, Li G, Wong S, Peng S, Zaretsky JM, Heath JR, Ribas A, Bethune MT, Baltimore D. Nat Methods. 2019 Feb;16(2):191-198. doi: 10.1038/s41592-018-0304-8. Epub 2019 Jan 28. 10.1038/s41592-018-0304-8 PubMed 30700902
