Skip to main content

A3Bi-Cas9n-UGI
(Plasmid #119135)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119135 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    BE3
  • Backbone manufacturer
    Liu Lab
  • Backbone size w/o insert (bp) 7825
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    APOBEC3B L1 intron-Cas9 nickase-UGI
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1469
  • Mutation
    L1 intron insertion
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    A3Bi-Cas9n-UGI was a gift from Reuben Harris (Addgene plasmid # 119135 ; http://n2t.net/addgene:119135 ; RRID:Addgene_119135)
  • For your References section:

    A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes. Martin AS, Salamango DJ, Serebrenik AA, Shaban NM, Brown WL, Harris RS. Sci Rep. 2019 Jan 24;9(1):497. doi: 10.1038/s41598-018-36739-9. 10.1038/s41598-018-36739-9 PubMed 30679582