Desmoplakin I affinity mutant (F40-based tension sensor)
(Plasmid #119190)

• Purpose: The affinity mutant for the F40-based human desmoplakin I tension sensor incorporates a point mutation that exhibits enhanced keratin association.
• Depositing Lab: Alex Dunn
• Depositing Organization: Stanford University
  Located in United States of America
• Publication: Price et al Nat Commun. 2018 Dec 11;9(1):5284. doi: 10.1038/s41467-018-07523-0.

Backbone

• Vector backbone: pSBtet-Pur
• Backbone manufacturer: Eric Kowarz
• Backbone size w/o insert (bp): 5569
• Total vector size (bp): 16228
• Vector type: Mammalian Expression ; Transposon
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human Desmoplakin I(S2849G)-[mTFP1-F40-mEYFP] (internal-1945)
• Alt name: Desmoplakin I affinity mutant (F40-based tension sensor)
• Alt name: DPI-TS-S2849G
• Species: H. sapiens (human)
• Insert Size (bp): 10659
• Mutation: inserted F40-based tension sensor module after aa1945; S2849G in DPI which exhibits increased keratin association
• GenBank ID: NM_004415.3
• Entrez Gene: DSP (a.k.a. DCWHKTA, DP)
• Promoter: TCE
• Tag / Fusion Protein:
  • mTFP1-F40-mEYFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SfiI (not destroyed)
• 3′ cloning site: SfiI (not destroyed)
• 5′ sequencing primer: CCTGGAGCCAATTCCAACTCT
• 3′ sequencing primer: CACTGCATTCTTGTTGTGGTT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Desmoplakin I-GFP (Addgene, #32227) from Kathleen Green used as a template for Desmoplakin I and pSBtet-Pur (Addgene plasmid #60507) from Eric Kowarz used as a backbone.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 119190-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 119190-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.