Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Desmoplakin I affinity mutant (F40-based tension sensor)
(Plasmid #119190)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 119190 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSBtet-Pur
  • Backbone manufacturer
    Eric Kowarz
  • Backbone size w/o insert (bp) 5569
  • Total vector size (bp) 16228
  • Vector type
    Mammalian Expression ; Transposon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human Desmoplakin I(S2849G)-[mTFP1-F40-mEYFP] (internal-1945)
  • Alt name
    Desmoplakin I affinity mutant (F40-based tension sensor)
  • Alt name
    DPI-TS-S2849G
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    10659
  • Mutation
    inserted F40-based tension sensor module after aa1945; S2849G in DPI which exhibits increased keratin association
  • GenBank ID
    NM_004415.3
  • Entrez Gene
    DSP (a.k.a. DCWHKTA, DP)
  • Promoter TCE
  • Tag / Fusion Protein
    • mTFP1-F40-mEYFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer CCTGGAGCCAATTCCAACTCT
  • 3′ sequencing primer CACTGCATTCTTGTTGTGGTT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Desmoplakin I affinity mutant (F40-based tension sensor) was a gift from Alex Dunn (Addgene plasmid # 119190 ; http://n2t.net/addgene:119190 ; RRID:Addgene_119190)
  • For your References section:

    Mechanical loading of desmosomes depends on the magnitude and orientation of external stress. Price AJ, Cost AL, Ungewiss H, Waschke J, Dunn AR, Grashoff C. Nat Commun. 2018 Dec 11;9(1):5284. doi: 10.1038/s41467-018-07523-0. 10.1038/s41467-018-07523-0 PubMed 30538252