Desmoplakin I affinity mutant (F40-based tension sensor)
(Plasmid
#119190)
-
PurposeThe affinity mutant for the F40-based human desmoplakin I tension sensor incorporates a point mutation that exhibits enhanced keratin association.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119190 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSBtet-Pur
-
Backbone manufacturerEric Kowarz
- Backbone size w/o insert (bp) 5569
- Total vector size (bp) 16228
-
Vector typeMammalian Expression ; Transposon
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman Desmoplakin I(S2849G)-[mTFP1-F40-mEYFP] (internal-1945)
-
Alt nameDesmoplakin I affinity mutant (F40-based tension sensor)
-
Alt nameDPI-TS-S2849G
-
SpeciesH. sapiens (human)
-
Insert Size (bp)10659
-
Mutationinserted F40-based tension sensor module after aa1945; S2849G in DPI which exhibits increased keratin association
-
GenBank IDNM_004415.3
-
Entrez GeneDSP (a.k.a. DCWHKTA, DP)
- Promoter TCE
-
Tag
/ Fusion Protein
- mTFP1-F40-mEYFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer CCTGGAGCCAATTCCAACTCT
- 3′ sequencing primer CACTGCATTCTTGTTGTGGTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDesmoplakin I-GFP (Addgene, #32227) from Kathleen Green used as a template for Desmoplakin I and pSBtet-Pur (Addgene plasmid #60507) from Eric Kowarz used as a backbone.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Desmoplakin I affinity mutant (F40-based tension sensor) was a gift from Alex Dunn (Addgene plasmid # 119190 ; http://n2t.net/addgene:119190 ; RRID:Addgene_119190) -
For your References section:
Mechanical loading of desmosomes depends on the magnitude and orientation of external stress. Price AJ, Cost AL, Ungewiss H, Waschke J, Dunn AR, Grashoff C. Nat Commun. 2018 Dec 11;9(1):5284. doi: 10.1038/s41467-018-07523-0. 10.1038/s41467-018-07523-0 PubMed 30538252