Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pFUGW-RapACR_T111C-EYFP
(Plasmid #119195)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 119195 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFUGW
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Anion channelrhodopsin RapACR fast mutant T111C
  • Species
    Rhodomonas salina
  • Insert Size (bp)
    921
  • Mutation
    changed threonine 111 to cysteine
  • GenBank ID
    MG831192
  • Promoter Ubiquitin
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ATGCGCTCGGGGTTGGCGAGTGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUGW-RapACR_T111C-EYFP was a gift from John Spudich (Addgene plasmid # 119195 ; http://n2t.net/addgene:119195 ; RRID:Addgene_119195)
  • For your References section:

    Extending the Time Domain of Neuronal Silencing with Cryptophyte Anion Channelrhodopsins. Govorunova EG, Sineshchekov OA, Hemmati R, Janz R, Morelle O, Melkonian M, Wong GK, Spudich JL. eNeuro. 2018 Jul 10;5(3). pii: eN-MNT-0174-18. doi: 10.1523/ENEURO.0174-18.2018. eCollection 2018 May-Jun. eN-MNT-0174-18 [pii] PubMed 30027111