pJMP1170
(Plasmid
#119252)
-
Purposerfp "test" strain
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119252 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneR6Kgamma
-
Vector typeBacterial Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)BW25141
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA NT1/RR1 (rfp)
-
gRNA/shRNA sequenceAACTTTCAGTTTAGCGGTCT
-
MutationD10A and H840A
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJMP1170 was a gift from Carol Gross & Jason Peters & Oren Rosenberg (Addgene plasmid # 119252 ; http://n2t.net/addgene:119252 ; RRID:Addgene_119252) -
For your References section:
Enabling genetic analysis of diverse bacteria with Mobile-CRISPRi. Peters JM, Koo BM, Patino R, Heussler GE, Hearne CC, Qu J, Inclan YF, Hawkins JS, Lu CHS, Silvis MR, Harden MM, Osadnik H, Peters JE, Engel JN, Dutton RJ, Grossman AD, Gross CA, Rosenberg OS. Nat Microbiol. 2019 Jan 7. pii: 10.1038/s41564-018-0327-z. doi: 10.1038/s41564-018-0327-z. 10.1038/s41564-018-0327-z PubMed 30617347