Skip to main content

pJMP1239
(Plasmid #119263)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119263 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    R6Kgamma
  • Vector type
    Bacterial Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    BW25141
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA folA (P. aeruginosa)
  • gRNA/shRNA sequence
    CGCGCGGTTCTCGCCAAGGG
  • Mutation
    D10A and H840A

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJMP1239 was a gift from Carol Gross & Jason Peters & Oren Rosenberg (Addgene plasmid # 119263 ; http://n2t.net/addgene:119263 ; RRID:Addgene_119263)
  • For your References section:

    Enabling genetic analysis of diverse bacteria with Mobile-CRISPRi. Peters JM, Koo BM, Patino R, Heussler GE, Hearne CC, Qu J, Inclan YF, Hawkins JS, Lu CHS, Silvis MR, Harden MM, Osadnik H, Peters JE, Engel JN, Dutton RJ, Grossman AD, Gross CA, Rosenberg OS. Nat Microbiol. 2019 Jan 7. pii: 10.1038/s41564-018-0327-z. doi: 10.1038/s41564-018-0327-z. 10.1038/s41564-018-0327-z PubMed 30617347