Skip to main content

nLuc_AP10_PPVs_P9mS
(Plasmid #119302)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119302 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5443
  • Total vector size (bp) 7249
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    split nLuc fused to antiparallel Coiled-coil AP10 connected with P9mS via PPV cleavable linker
  • Alt name
    nLuc_AP10_PPVs_P9mS
  • Insert Size (bp)
    1806
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    nLuc_AP10_PPVs_P9mS was a gift from Roman Jerala (Addgene plasmid # 119302 ; http://n2t.net/addgene:119302 ; RRID:Addgene_119302)
  • For your References section:

    Design of fast proteolysis-based signaling and logic circuits in mammalian cells. Fink T, Lonzaric J, Praznik A, Plaper T, Merljak E, Leben K, Jerala N, Lebar T, Strmsek Z, Lapenta F, Bencina M, Jerala R. Nat Chem Biol. 2019 Feb;15(2):115-122. doi: 10.1038/s41589-018-0181-6. Epub 2018 Dec 10. 10.1038/s41589-018-0181-6 PubMed 30531965