-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 11948 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3970
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUb-R-YFP
-
Alt nameUbiquitin
-
Alt nameUb
-
Insert Size (bp)990
-
MutationUbiquitin fused to N-terminus of YFP. Arginine at position 1 between Ub and YFP (see article 10802622). N-end rule degradation signal.
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CMV-F (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The ubiquitin open reading frame was amplified by PCR from the Ub-Pro-Gal plasmid with the sense primer 5'-GCG GAATTCACCATGCAGATCTTCGTGAAGACT-3' and the antisense primer 5'-GCG GGATCCTGTCGACCAAGCTTCCCXXX
CCCACCTCTGAGACGGAGTAC-3' where the XXX leads to an arginine at position 1 (see article 10802622, Figure 1). The PCR product was cloned into the EcoRI and BamHI sites of the EGFP-N1 vector from Clontech.
Subsequently, the GFP open reading frame was replaced with a YFP open reading frame using the PinAI and NotI restriction sites.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ub-R-YFP was a gift from Nico Dantuma (Addgene plasmid # 11948 ; http://n2t.net/addgene:11948 ; RRID:Addgene_11948) -
For your References section:
Endoplasmic reticulum stress compromises the ubiquitin-proteasome system. Menendez-Benito V, Verhoef LG, Masucci MG, Dantuma NP. Hum Mol Genet. 2005 Oct 1. 14(19):2787-99. 10.1093/hmg/ddi312 PubMed 16103128