Skip to main content

pAAV_hsyn_NES-his-CaMPARI2-F391W-L398V
(Plasmid #119723)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119723 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4267
  • Total vector size (bp) 5575
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    CaMPARI2
  • Species
    Synthetic
  • Insert Size (bp)
    1308
  • Mutation
    F391W, L398V
  • Promoter hSyn1
  • Tag / Fusion Protein
    • NES-his (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer syn-sense2 GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer P5E gtaatccagaggttgattatcg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    CaMPARI2
  • Species
    Synthetic
  • Insert Size (bp)
    1308

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer syn-sense2 GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer P5E gtaatccagaggttgattatcg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_hsyn_NES-his-CaMPARI2-F391W-L398V was a gift from Thomas Oertner (Addgene plasmid # 119723 ; http://n2t.net/addgene:119723 ; RRID:Addgene_119723)
  • For your References section:

    Improved methods for marking active neuron populations. Moeyaert B, Holt G, Madangopal R, Perez-Alvarez A, Fearey BC, Trojanowski NF, Ledderose J, Zolnik TA, Das A, Patel D, Brown TA, Sachdev RNS, Eickholt BJ, Larkum ME, Turrigiano GG, Dana H, Gee CE, Oertner TG, Hope BT, Schreiter ER. Nat Commun. 2018 Oct 25;9(1):4440. doi: 10.1038/s41467-018-06935-2. 10.1038/s41467-018-06935-2 PubMed 30361563