pAAV_hsyn_NES-his-CaMPARI2-F391W-L398V
(Plasmid
#119723)
-
PurposeAAV vector expressing CaMPARI2_F391W-L398V (Kd = 174nM), a photoconvertible fluorescent protein-based calcium integrator, in neurons
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119723 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4267
- Total vector size (bp) 5575
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCaMPARI2
-
SpeciesSynthetic
-
Insert Size (bp)1308
-
MutationF391W, L398V
- Promoter hSyn1
-
Tag
/ Fusion Protein
- NES-his (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer syn-sense2 GACTCAGCGCTGCCTCAGTCTG
- 3′ sequencing primer P5E gtaatccagaggttgattatcg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCaMPARI2
-
SpeciesSynthetic
-
Insert Size (bp)1308
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer syn-sense2 GACTCAGCGCTGCCTCAGTCTG
- 3′ sequencing primer P5E gtaatccagaggttgattatcg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCaMPARI 2.0 was a kind gift of Eric Schreiter Lab (Janelia Farm)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_hsyn_NES-his-CaMPARI2-F391W-L398V was a gift from Thomas Oertner (Addgene plasmid # 119723 ; http://n2t.net/addgene:119723 ; RRID:Addgene_119723) -
For your References section:
Improved methods for marking active neuron populations. Moeyaert B, Holt G, Madangopal R, Perez-Alvarez A, Fearey BC, Trojanowski NF, Ledderose J, Zolnik TA, Das A, Patel D, Brown TA, Sachdev RNS, Eickholt BJ, Larkum ME, Turrigiano GG, Dana H, Gee CE, Oertner TG, Hope BT, Schreiter ER. Nat Commun. 2018 Oct 25;9(1):4440. doi: 10.1038/s41467-018-06935-2. 10.1038/s41467-018-06935-2 PubMed 30361563