Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV_hsyn_NES-his-CaMPARI2-F391W-L398V
(Plasmid #119723)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119723 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4267
  • Total vector size (bp) 5575
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    CaMPARI2
  • Species
    Synthetic
  • Insert Size (bp)
    1308
  • Mutation
    F391W, L398V
  • Promoter hSyn1
  • Tag / Fusion Protein
    • NES-his (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer syn-sense2 GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer P5E gtaatccagaggttgattatcg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    CaMPARI2
  • Species
    Synthetic
  • Insert Size (bp)
    1308

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer syn-sense2 GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer P5E gtaatccagaggttgattatcg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_hsyn_NES-his-CaMPARI2-F391W-L398V was a gift from Thomas Oertner (Addgene plasmid # 119723 ; http://n2t.net/addgene:119723 ; RRID:Addgene_119723)
  • For your References section:

    Improved methods for marking active neuron populations. Moeyaert B, Holt G, Madangopal R, Perez-Alvarez A, Fearey BC, Trojanowski NF, Ledderose J, Zolnik TA, Das A, Patel D, Brown TA, Sachdev RNS, Eickholt BJ, Larkum ME, Turrigiano GG, Dana H, Gee CE, Oertner TG, Hope BT, Schreiter ER. Nat Commun. 2018 Oct 25;9(1):4440. doi: 10.1038/s41467-018-06935-2. 10.1038/s41467-018-06935-2 PubMed 30361563