014LP-pAAV-ANF-657- Cre-pA
(Plasmid
#120279)
-
PurposeAAV vector for Atrial specific Cre recombinase expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120279 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEMBL8
- Backbone size w/o insert (bp) 2500
- Total vector size (bp) 4902
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre
-
Alt nameCre recombinase
-
SpeciesPhage P1
- Promoter ANF promoter
-
Tag
/ Fusion Protein
- CRE (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ggttctggtgaacagtcagg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
014LP-pAAV-ANF-657- Cre-pA was a gift from Xander Wehrens (Addgene plasmid # 120279 ; http://n2t.net/addgene:120279 ; RRID:Addgene_120279) -
For your References section:
Atrial-Specific Gene Delivery Using an Adeno-Associated Viral Vector. Ni L, Scott L Jr, Campbell HM, Pan X, Alsina KM, Reynolds J, Philippen LE, Hulsurkar M, Lagor WR, Li N, Wehrens XHT. Circ Res. 2019 Jan 18;124(2):256-262. doi: 10.1161/CIRCRESAHA.118.313811. 10.1161/CIRCRESAHA.118.313811 PubMed 30582449