Skip to main content

pET-28a(+)-FGF1-4X
(Plasmid #120282)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120282 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-28a (+)
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5369
  • Total vector size (bp) 5792
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    BL21 Star/DE3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Basic fibroblast growth factor 1 mutant
  • Alt name
    FGF1 mutant
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    423
  • Mutation
    Codon optimized for E. Coli production
  • Promoter T7 Promoter
  • Tag / Fusion Protein
    • 6x His tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • 3′ sequencing primer CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    Printed sequence service from SGI

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/685503v2 for BioRxiv preprint

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-28a(+)-FGF1-4X was a gift from Paul Burridge (Addgene plasmid # 120282 ; http://n2t.net/addgene:120282 ; RRID:Addgene_120282)
  • For your References section:

    Negligible-Cost and Weekend-Free Chemically Defined Human iPSC Culture. Kuo HH, Gao X, DeKeyser JM, Fetterman KA, Pinheiro EA, Weddle CJ, Fonoudi H, Orman MV, Romero-Tejeda M, Jouni M, Blancard M, Magdy T, Epting CL, George AL Jr, Burridge PW. Stem Cell Reports. 2020 Jan 9. pii: S2213-6711(19)30446-1. doi: 10.1016/j.stemcr.2019.12.007. 10.1016/j.stemcr.2019.12.007 PubMed 31928950