pGL4.23-MYC-e4
(Plasmid
#120342)
-
PurposepGL4.23-MYC with an enhancer cloned upstream of the MYC promoter.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120342 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL4.23-MYC
- Backbone size w/o insert (bp) 5322
- Total vector size (bp) 7438
-
Modifications to backbonepGL4.23-MYC is a modified version of the Promega pGL4.23 vector. Contains the MYC promoter in place of the minimal promoter and polyadenylation signals flanking the enhancer cloning site.
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namechr8:129060477-129062593 (hg19)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2116
- Promoter MYC
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACTGCGGCTCCTCATCGCG
- 3′ sequencing primer TCCGGTGCCCTGAATGAACT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4.23-MYC-e4 was a gift from Eric Lander (Addgene plasmid # 120342 ; http://n2t.net/addgene:120342 ; RRID:Addgene_120342) -
For your References section:
Systematic mapping of functional enhancer-promoter connections with CRISPR interference. Fulco CP, Munschauer M, Anyoha R, Munson G, Grossman SR, Perez EM, Kane M, Cleary B, Lander ES, Engreitz JM. Science. 2016 Sep 29. pii: aag2445. 10.1126/science.aag2445 PubMed 27708057