Skip to main content

pLEX-FHH-Empty Vector-IRES-Puro
(Plasmid #120568)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120568 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLEX
  • Backbone manufacturer
    Thermo Scientific
  • Backbone size (bp) 10778
  • Vector type
    Mammalian Expression, Lentiviral
  • Promoter CMV
  • Selectable markers
    Puromycin
  • Tag / Fusion Protein
    • Flag-HA-6xHis (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CACCAAAATCAACGGGACTT
  • 3′ sequencing primer ATATAGACAAACGCACACCGGCCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLEX-FHH-Empty Vector-IRES-Puro was a gift from Paul Khavari (Addgene plasmid # 120568 ; http://n2t.net/addgene:120568 ; RRID:Addgene_120568)
  • For your References section:

    The Functional Proximal Proteome of Oncogenic Ras Includes mTORC2. Kovalski JR, Bhaduri A, Zehnder AM, Neela PH, Che Y, Wozniak GG, Khavari PA. Mol Cell. 2019 Jan 4. pii: S1097-2765(18)31031-1. doi: 10.1016/j.molcel.2018.12.001. 10.1016/j.molcel.2018.12.001 PubMed 30639242