Skip to main content

W45A mutant of H3K9me3 biosensor
(Plasmid #120808)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120808 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGGS vector
  • Backbone size w/o insert (bp) 4717
  • Total vector size (bp) 7021
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Truncated YPet-HP1(W45A mutation)-EV linker-ECFP-mouse histone H3
  • Species
    M. musculus (mouse), D. melanogaster (fly), Synthetic
  • Insert Size (bp)
    2304
  • Mutation
    Tryptophan 45 is mutated to Alanine 45 on HP1 domain
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GCCTCTGCTAACCATGTTCATGCC
  • 3′ sequencing primer CAGATGCTCAAGGGGCTTCATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    W45A mutant of H3K9me3 biosensor was a gift from Yingxiao Wang (Addgene plasmid # 120808 ; http://n2t.net/addgene:120808 ; RRID:Addgene_120808)
  • For your References section:

    Coordinated histone modifications and chromatin reorganization in a single cell revealed by FRET biosensors. Peng Q, Lu S, Shi Y, Pan Y, Limsakul P, Chernov AV, Qiu J, Chai X, Shi Y, Wang P, Ji Y, Li YJ, Strongin AY, Verkhusha VV, Izpisua Belmonte JC, Ren B, Wang Y, Chien S, Wang Y. Proc Natl Acad Sci U S A. 2018 Nov 26. pii: 1811818115. doi: 10.1073/pnas.1811818115. 10.1073/pnas.1811818115 PubMed 30478057