Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET28a-mH6-Cas12g1
(Plasmid #120879)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 120879 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET-28a+
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5495
  • Total vector size (bp) 7802
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Cas12g1
  • Alt name
    LbCas12g
  • Species
    Synthetic
  • Insert Size (bp)
    2307
  • Promoter lac
  • Tag / Fusion Protein
    • mH6 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at [email protected]. mH6 sequence: ATGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCAC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-mH6-Cas12g1 was a gift from Arbor Biotechnologies (Addgene plasmid # 120879 ; http://n2t.net/addgene:120879 ; RRID:Addgene_120879)
  • For your References section:

    Functionally diverse type V CRISPR-Cas systems. Yan WX, Hunnewell P, Alfonse LE, Carte JM, Keston-Smith E, Sothiselvam S, Garrity AJ, Chong S, Makarova KS, Koonin EV, Cheng DR, Scott DA. Science. 2019 Jan 4;363(6422):88-91. doi: 10.1126/science.aav7271. Epub 2018 Dec 6. 10.1126/science.aav7271 PubMed 30523077