-
PurposeDonor plasmid targeting human AAVS1 safe harbor locus to generate GCaMP6s gene knockin. Contains two homologous arms flanking T2A-Puro resistance gene and CAG-driven GCaMP6s gene.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120896 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneAAVS1-CAG-hrGFP
-
Backbone manufacturerSu-Chun Zhang
- Backbone size w/o insert (bp) 8085
- Total vector size (bp) 11644
-
Modifications to backbonereplace hrGFP with GCaMP6s
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP6s
-
SpeciesSynthetic
-
Insert Size (bp)1353
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer pCAGGS-5 (GGTTCGGCTTCTGGCGTGTGACC)
- 3′ sequencing primer Bglob-pA-R (TTTTGGCAGAGGGAAAAAGA) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-Puro-CAG-GCaMP6s was a gift from Xiaojun Lian (Addgene plasmid # 120896 ; http://n2t.net/addgene:120896 ; RRID:Addgene_120896) -
For your References section:
An Ultrasensitive Calcium Reporter System via CRISPR-Cas9-Mediated Genome Editing in Human Pluripotent Stem Cells. Jiang Y, Zhou Y, Bao X, Chen C, Randolph LN, Du J, Lian XL. iScience. 2018 Oct 12;9:27-35. doi: 10.1016/j.isci.2018.10.007. 10.1016/j.isci.2018.10.007 PubMed 30368079