pLenti-STAT3-linker-TagGFP2
(Plasmid
#121427)
-
PurposeWT STAT3 inserted using Infusion Cloning into MluI and EcoRI digested pLenti-Origene-Nrf21.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 121427 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti-Origene
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSTAT3-linker-TagGFP2
-
SpeciesH. sapiens (human)
- Promoter CMV
-
Tag
/ Fusion Protein
- TagGFP2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer TGCAGGGGAAAGAATAGTAGAC
- 3′ sequencing primer CAAGCGAGGACTGAGCATCG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAntonia A. Dominguez and Lei S. Qi, Stanford University
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-STAT3-linker-TagGFP2 was a gift from Ovijit Chaudhuri & Stanley Qi (Addgene plasmid # 121427 ; http://n2t.net/addgene:121427 ; RRID:Addgene_121427) -
For your References section:
YAP-independent mechanotransduction drives breast cancer progression. Lee JY, Chang JK, Dominguez AA, Lee HP, Nam S, Chang J, Varma S, Qi LS, West RB, Chaudhuri O. Nat Commun. 2019 Apr 23;10(1):1848. doi: 10.1038/s41467-019-09755-0. 10.1038/s41467-019-09755-0 PubMed 31015465