-
Purposeexpression of AB1-fused-dcas9 plasmids
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 121513 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHR
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersmcherry fluorescence
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9
-
Insert Size (bp)4101
- Promoter PGK
-
Tags
/ Fusion Proteins
- AB1 (N terminal on insert)
- P2A-mcherry (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGTGCAGGGGAAAGAATAGTAGAC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-PGK-ABI-dCas9-P2A-mcherry was a gift from Stanley Qi (Addgene plasmid # 121513 ; http://n2t.net/addgene:121513 ; RRID:Addgene_121513) -
For your References section:
CRISPR-Mediated Programmable 3D Genome Positioning and Nuclear Organization. Wang H, Xu X, Nguyen CM, Liu Y, Gao Y, Lin X, Daley T, Kipniss NH, La Russa M, Qi LS. Cell. 2018 Nov 15;175(5):1405-1417.e14. doi: 10.1016/j.cell.2018.09.013. Epub 2018 Oct 11. 10.1016/j.cell.2018.09.013 PubMed 30318144