Skip to main content

pHR-PGK-ABI-dCas9-P2A-mcherry
(Plasmid #121513)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121513 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    mcherry fluorescence

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCas9
  • Insert Size (bp)
    4101
  • Promoter PGK
  • Tags / Fusion Proteins
    • AB1 (N terminal on insert)
    • P2A-mcherry (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGTGCAGGGGAAAGAATAGTAGAC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-PGK-ABI-dCas9-P2A-mcherry was a gift from Stanley Qi (Addgene plasmid # 121513 ; http://n2t.net/addgene:121513 ; RRID:Addgene_121513)
  • For your References section:

    CRISPR-Mediated Programmable 3D Genome Positioning and Nuclear Organization. Wang H, Xu X, Nguyen CM, Liu Y, Gao Y, Lin X, Daley T, Kipniss NH, La Russa M, Qi LS. Cell. 2018 Nov 15;175(5):1405-1417.e14. doi: 10.1016/j.cell.2018.09.013. Epub 2018 Oct 11. 10.1016/j.cell.2018.09.013 PubMed 30318144