-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 12177 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIS2
-
Backbone manufacturerDavid Bartel Lab
- Backbone size (bp) 3745
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer EBV rev primer (GTGGTTTGTCCAAACTCATC) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pIS2 was derived from pRL-SV40. More cloning sites have been added (the lower case is the pRL-SV40 and the caps is the new sequence that has been inserted): gaacaataattctagGAGCTCTATACCGGTCTCGATATCACTACTAGTGTtctagagcggccgct . The plasmid contains a renilla luciferase reporter driven by the SV40 early enhancer/promoter. Search Addgene's vector database for more information on pRL-SV40 from Promega.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIS2 was a gift from David Bartel (Addgene plasmid # 12177 ; http://n2t.net/addgene:12177 ; RRID:Addgene_12177) -
For your References section:
The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB, Bartel DP. Science. 2005 Dec 16. 310(5755):1817-21. 10.1126/science.1121158 PubMed 16308420