-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 12179 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepIS1
-
Backbone manufacturerBartel Lab
- Backbone size (bp) 4085
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer n/a
- 3′ sequencing primer EBV rev primer (GTGGTTTGTCCAAACTCATC) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pIS1 was derived from pRL-TK by adding more cloning sites. The plasmid contains a renilla luciferase reporter driven by the HSV TK promoter. Search Addgene's vector database for more information on pRL-TK from Promega.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIS1 was a gift from David Bartel (Addgene plasmid # 12179 ; http://n2t.net/addgene:12179 ; RRID:Addgene_12179)