Skip to main content

pLH-sgRNA-Sirius-8XPP7
(Plasmid #121940)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121940 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1
  • Backbone size w/o insert (bp) 8171
  • Total vector size (bp) 8591
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    May require 2 days to grow
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA-Sirius-8XPP7
  • Species
    Synthetic
  • Insert Size (bp)
    420
  • Promoter human U6 promoter
  • Tag / Fusion Protein
    • no

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sbf I (not destroyed)
  • 3′ cloning site EcoR I (not destroyed)
  • 5′ sequencing primer cccttcaccgagggcctatttccc
  • 3′ sequencing primer CTATTCTTTCCCCTGCACTGTACCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLH-sgRNA-Sirius-8XPP7 was a gift from Thoru Pederson (Addgene plasmid # 121940 ; http://n2t.net/addgene:121940 ; RRID:Addgene_121940)
  • For your References section:

    CRISPR-Sirius: RNA scaffolds for signal amplification in genome imaging. Ma H, Tu LC, Naseri A, Chung YC, Grunwald D, Zhang S, Pederson T. Nat Methods. 2018 Nov;15(11):928-931. doi: 10.1038/s41592-018-0174-0. Epub 2018 Oct 30. 10.1038/s41592-018-0174-0 PubMed 30377374