pCMV6M-Pak1 P191G, P192A
(Plasmid
#12213)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 12213 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV6
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4900
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePak1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2000
-
MutationPIX (PAK-interacting exchange factor) binding mutant: P191G, P192A. NarI site added as a result of site-directed mutagenesis
-
Entrez GenePAK1 (a.k.a. IDDMSSD, PAKalpha, alpha-PAK, p65-PAK)
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTCGTTTAGTGAACCGTCAG
- 3′ sequencing primer GGAACTTCCAAGGCCAGGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Pak1 contains a G401S mutation. Depositor states that this mutation should not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV6M-Pak1 P191G, P192A was a gift from Jonathan Chernoff (Addgene plasmid # 12213 ; http://n2t.net/addgene:12213 ; RRID:Addgene_12213)