-
PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs2 incorporated at the 3' end of the sgRNA constant region.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122237 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene, #60955)
- Total vector size (bp) 8910
-
Modifications to backboneA modified sgRNA (with capture sequence 2 at the 3' end of the constant region/tracr) was inserted using BlpI and XhoI sites.
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin ; BFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesgRNA with cs2 at the 3' end of the constant region
-
gRNA/shRNA sequenceeGFP-NT2 - non-targeting
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BlpI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer cagcacaaaaggaaactcacc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBA900 was a gift from Jonathan Weissman (Addgene plasmid # 122237 ; http://n2t.net/addgene:122237 ; RRID:Addgene_122237) -
For your References section:
Combinatorial single-cell CRISPR screens by direct guide RNA capture and targeted sequencing. Replogle JM, Norman TM, Xu A, Hussmann JA, Chen J, Cogan JZ, Meer EJ, Terry JM, Riordan DP, Srinivas N, Fiddes IT, Arthur JG, Alvarado LJ, Pfeiffer KA, Mikkelsen TS, Weissman JS, Adamson B. Nat Biotechnol. 2020 Aug;38(8):954-961. doi: 10.1038/s41587-020-0470-y. Epub 2020 Mar 30. 10.1038/s41587-020-0470-y PubMed 32231336