Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #122237)


Item Catalog # Description Quantity Price (USD)
Plasmid 122237 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene, #60955)
  • Total vector size (bp) 8910
  • Modifications to backbone
    A modified sgRNA (with capture sequence 2 at the 3' end of the constant region/tracr) was inserted using BlpI and XhoI sites.
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin ; BFP

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
    sgRNA with cs2 at the 3' end of the constant region
  • gRNA/shRNA sequence
    eGFP-NT2 - non-targeting
  • Species

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BlpI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer cagcacaaaaggaaactcacc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBA900 was a gift from Jonathan Weissman (Addgene plasmid # 122237 ; ; RRID:Addgene_122237)
  • For your References section:

    Combinatorial single-cell CRISPR screens by direct guide RNA capture and targeted sequencing. Replogle JM, Norman TM, Xu A, Hussmann JA, Chen J, Cogan JZ, Meer EJ, Terry JM, Riordan DP, Srinivas N, Fiddes IT, Arthur JG, Alvarado LJ, Pfeiffer KA, Mikkelsen TS, Weissman JS, Adamson B. Nat Biotechnol. 2020 Aug;38(8):954-961. doi: 10.1038/s41587-020-0470-y. Epub 2020 Mar 30. 10.1038/s41587-020-0470-y PubMed 32231336