-
PurposeCROP-seq vector optimized for sgRNA expression and CRISPRi activity. This vector expresses a eGFP-NT2 sgRNA with modified U6 promotor and sgRNA constant region.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122239 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCROPseq-Guide-Puro (Addgene, #86708)
- Total vector size (bp) 8522
-
Modifications to backboneFirst, an intermediate vector was constructed by replacing the existing selectable marker in CROPseq-Guide-Puro with BFP (synthesized dsDNA inserted by Gibson assembly using PstI and MluI). Then pBA950 was made by replacing the entire human U6-driven sgRNA expression cassette with the sgRNA expression cassette from pU6-sgRNA EF1Alpha-puro-T2A-BFP (synthesized dsDNA inserted between PpuMI and NcoI by Gibson assembly). This cassette is driven by a modified mouse U6 promoter and encodes a BlpI-containing sgRNA(F+E) programmed with EGFP-NT2.
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBFP selectable marker, plus a modified mU6 promoter and sgRNA constant region for optimized CRISPRi activity
-
gRNA/shRNA sequenceEGFP-NT2
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cagcacaaaaggaaactcacc
- 3′ sequencing primer TCAAGTTGATAACGGACTAGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBA950 was a gift from Jonathan Weissman (Addgene plasmid # 122239 ; http://n2t.net/addgene:122239 ; RRID:Addgene_122239) -
For your References section:
Combinatorial single-cell CRISPR screens by direct guide RNA capture and targeted sequencing. Replogle JM, Norman TM, Xu A, Hussmann JA, Chen J, Cogan JZ, Meer EJ, Terry JM, Riordan DP, Srinivas N, Fiddes IT, Arthur JG, Alvarado LJ, Pfeiffer KA, Mikkelsen TS, Weissman JS, Adamson B. Nat Biotechnol. 2020 Aug;38(8):954-961. doi: 10.1038/s41587-020-0470-y. Epub 2020 Mar 30. 10.1038/s41587-020-0470-y PubMed 32231336